Ola , Mohamed , Doreen , and Eman: Protective role of Lipoprotein-Associated Phospholipase A2 Gene (A379V) Polymorphism against Myocardial Infarction among Egyptians.

Introduction

The recognition that atherosclerosis has a strong inflammatory component has stimulated a great deal of research on the role of inflammatory mediators in the atherosclerotic disease process.1 Oxidation of low density lipoproteins (LDLs) is an initial step in atherogenesis, that generates a myriad of proinflammatory phospholipids, including platelet-activating factor (PAF) and its analogs,2, 3 which are implicated in signaling and activation of pro-inflammatory cells such as platelets, leukocytes and macrophages.4

Platelet-activating factor exerts its various effects via the G-protein-coupled PAF-receptor that binds PAF with high affinity.5 PAF and its biologically active analogs are degraded by lipoprotein-associated phospholipase A2 (Lp-PLA2), a circulating enzyme bound mainly to LDLs, and to a lesser extent to high density lipoproteins (HDLs).6, 7 Lipoprotein-associated phospholipase A2 is also known as PAF-acetylhydrolase (PAF-AH). Besides having an anti-inflammatory activity by degrading PAF, Lp-PLA2 may also exert a pro-inflammatory activity by massively hydrolyzing phospholipids to generate lyso-phosphatidylcholine (lyso-PC) and free oxidized fatty acids, both are pro-inflammatory mediators largely responsible for the pro-atherogenic activity of oxidized LDL.8

Lipoprotein associated phospholipase A2 is a member of the group VII family of PLA2 enzymes which are Ca2+-independent enzymes, consisting of 45.4 kDa polypeptide chains.9

With the classification of this enzyme as a positive risk factor in coronary heart disease, it has become a very attractive drug target. A specific inhibitor of this enzyme, Darapladib, was developed in 2003.10 This drug binds reversibly and noncovalently to human recombinant Lp-PLA2 and inhibits Lp- PLA2-mediated exogenous substrate hydrolysis in plasma and LDL in vitro.10 In vivo studies showed that darapladib treatment reduced the content of lyso-PC in pig atherosclerotic lesions, owing to inhibition of hydrolysis of endogenous phospholipids.11

The gene for Lp-PLA2, PLA2G7, has 12 exons and is located on chromosome 6p21.2 to 12. A large number of single nucleotide polymorphisms (SNPs) that affect Lp-PLA2 mass and activity in plasma have been described. Some variants are noted mainly in certain ethnic groups. The most frequently studied SNPs are R92H (rs1805017), I198T (rs1805018), V279P and A379V (rs1051931).12-14

The missense mutation of the PLA2G7 gene, which results in alanine (ACG) to valine (ATG) transition at position 379 of Lp-PLA2 protein, A379V (rs 1051931) (46672943 C > T), has been observed in Caucasians, Chinese, Taiwanese and South Koreans.15, 16, 17, 18, 19 This polymorphism is thought to decrease the substrate affinity of Lp-PLA2, possibly prolonging the activity of PAF, which in turn is associated with many inflammatory diseases.13

Table 1

Clinical Characteristics of the two studied groups.

Parameter (mean±SD) Patients (n=50) Controls (n=50)
Age (years) 48.34 ± 7.67 45.16 ± 8.73
Male 23 (46%) 25 (50%)
Female 27 (54%) 25 (50%)
TG (mg/dl) 187.82 ± 92.50* 112.82 ± 29.73
Cholesterol (mg/dl) 228.26 ± 71.98* 165.88 ± 30.11
LDL (mg/dl) 152.32 ± 62.08* 85.80 ± 25.36
HDL (mg/dl) 38.06 ± 13.77* 56.18 ± 12.64
CK (U/L) 1654.46 ± 1390.38* 80.04 ± 32.39
CK-MB (ng/ml) 163.06 ± 185.24* 0.47 ± 0.32
Troponin I (ng/ml) 61.92 ± 74.46* 0.0 ± 0.0
AST (U/L) 324.42 ± 266.37* 23.22 ± 10.09
LDH (U/L) 1261.64 ± 965.39* 151.16 ± 30.61
Hs-CRP (mg/L) 138.48 ± 145.80* 8.54 ± 10.17
Glucose (mg/dl) 110.88 ± 33.02* 97.74 ± 16.41

TG: Triglycerides, LDL: Low denisty lipoprotein, HDL: High denisty lipoprotein, CK: Total creatine kinase, CKMB: Creatine kinase MB isoform, AST: Aspartate transaminase, LDH: Lactate dehydrogenase, Hs-CRP: High sensitivity C-reactive protein. *p value < 0.05 compared with controls.

Materials and Methods

Study Population:

This study was conducted on fifty Egyptian patients; 23 males (46%) and 27 females (54%), all suffering from MI which was confirmed by ECG changes (ST segment elevation) and elevation of cardiac enzymes (CK-MB and troponin). All patients were recruited from the Cardiology Department at Alexandria Main University Hospital and their ages ranged between 32-65 years with a mean of 48 years. Patients with inflammatory or liver diseases were excluded to eliminate the relationship between this gene polymorphism and diseases other than MI.

Fifty healthy individuals, 25 males (50%) and 25 females (50%), whose ages ranged between 30-70 years with a mean of 45 years, were included as a control group. They had no history of hypertension, DM, atherosclerosis or cancer.

Full history was taken from all participants; including smoking habits, physical activity, alcohol consumption, drug history and medical history for hypertension and DM. Also, supine blood pressure was measured for all participants. All subjects signed a written informed consent before enrollment in the study. The study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki and has obtained the approval of the Medical Ethics Committee of the Faculty of Medicine, Alexandria University

Table 2

Clinical Characteristics of the two studied groups.

Lipid Profile Genotype Test of sig.
CC (n= 36) CT (n= 12) TT (n=2)
TG (mg/dl) Mean ±SD. 191.44 ± 93.18 188.92 ± 97.42 116.0 ± 11.31
Cholesterol (mg/dl) Mean ±SD. 224.92 ± 77.55 240.0 ± 57.18 213.50 ± 68.59
LDL (mg/dl) Mean ±SD. 149.31 ± 63.09 163.25 ± 61.73 141.0 ± 74.95
HDL (mg/dl) Mean ±SD. 37.75 ± 15.13 37.17 ± 9.59 49.0 ± 4.24

p: p value for comparing between the three genotype

KW: Kruskal Wallis test

F: F test (ANOVA)

*: Statistically significant at p ≤ 0.05

Routine Laboratory Investigations:

Three milliliters of whole blood were collected from every subject by aseptic veni-puncture in a plain red-topped vacutainer, left to clot slowly at room temperature for 15-30 minutes. The clot was removed by centrifugation at 1000-1200 g for 10 minutes, then the serum was used for measurement of lipid profile (triglycerides, total cholesterol, LDL and HDL), cardiac enzymes (CK- total, CK-MB, troponin, LDH, AST), hs- CRP and fasting blood glucose. All parameters were measured by chemistry auto-analyzer Dimension RxL Max (Siemens Health Care Diagnostics, USA).

Genomic Analysis for Detection of Lp-PLA2 A379V (rs 1051931) Gene Polymorphism by 5` Nuclease Allele Discrimination Assay using Real-Time PCR:

1- DNA Extraction:

Another 2 milliliters of whole blood were aseptically drawn into lavender-topped EDTA vacutainer. Genomic DNA was extracted from EDTA whole blood samples, using QIAGEN total DNA purification kit (QIAamp DNA blood mini kit, QIAGEN, Germany, cat. no. 51104) according to the manufacturer’s instructions. The DNA samples were stored at -20°C until use.

2- 5’Nuclease Allele Discrimination Assay using Real-Time PCR:

Ready-made “TaqMan SNP Genotyping Assay” (Assay ID C_2032800_20, catalog # 4351379, Applied Biosystems, USA) was used to detect Lp-PLA2 A379V SNP (rs1051931). In Lp-PLA2 A379V polymorphism (46672943 C > T), alanine (ACG) is replaced with valine (ATG), with the C allele being the major allele (coding for alanine) and the T allele being the minor one (coding for valine). This assay kit contains primer/ probe mixes (40X); 2 unlabeled sequence-specific forward and reverse primers to amplify the sequence of interest harboring the polymorphism and 2 labeled TaqMan minor groove binder (MGB) probes for detecting both the major C and the minor T alleles.

The first probe, labeled with FAM (green fluorescence) as the reporter dye at the 5’ end, detects the major C allele, present in alanine (ACG).

(AGCTTTGTTGCTAAGATCAATAGC TGC ATTTGAATCTATGTCTCCCTTTAA).

The second probe, labeled with VIC (yellow fluorescence) as the reporter dye at the 5’ end, detects the minor T allele, present in valine (ATG).

(AGCTTTGTTGCTAAGATCAATAGC TAC ATTTGAATCTATGTCTCCCTTTAA).

The PCR reaction mix was prepared. This 5’nuclease allele discrimination assay, using real-time PCR, was used to detect this genetic variant using the following thermal profile: holding at 95°C for 10 minutes followed by 40 cycles of denaturation (92°C for 15 seconds) and annealing/extension (60°C for 1 minute) in the Rotor Gene thermal cycler machine (serial no R0211172). A no template control (NTC) containing nucleasefree water, instead of DNA, was included in each run to exclude contamination.

The fluorescence profile of each sample was measured by the Rotor Gene software which plots a graphic presentation of the fluorescence against the number of cycles. The plotted fluorescence signals indicate which alleles are in each sample. The threshold cycle (Ct): is the cycle at which the instrument can distinguish the amplification generated fluorescence as being above the background signal. Positive cases are those with a Ct before cycle 40, while cases in whom no Ct was detected were considered negative. Amplification plot curve for A379 (FAM labeled) was constructed (Figure 1) and another for 379V (VIC labeled).

Table 3

Relation between the different genotypes and patients’ cardiac enzyme levels.

Cardiac Enzymes Genotype Test of sig.
CC (n= 36) CT (n= 12) TT (n=2)
CK (U/L) Mean ±SD. 1629.94 ± 1435.48 1929.67 ± 1296.0 444.50 ± 518.31
CK-MB (ng/ml) Mean ±SD. 149.95 ± 130.17 222.49 ± 302.60 42.40 ± 57.28
TnI (ng/ml) Mean ±SD. 63.03 ± 70.99 68.12 ± 89.58 4.86 ± 0.40
AST (U/L) Mean ±SD. 323.81 ± 255.50 353.0 ± 315.25 164.0 ± 193.75
LDH (U/L) Mean ±SD. 1213.61 ± 818.83 1555.08 ± 1330.47 365.50 ± 74.25 KWp = 0.128

p: p value for comparing between the three genotypes. KW: Kruskal Wallis test *: Statistically significant at p ≤ 0.05

Table 4

Relation between the different genotypes and patients’ glucose and hs-CRP levels.

Parameter Genotype Test of sig.
CC (n= 36) CT (n= 12) TT (n=2)
Genotype 112.72 ± 37.58 108.83 ± 15.99 444.50 ± 518.31
hs-CRP (mg/L) Mean ±SD. 161.93 ± 144.53 90.02 ± 143.96 4.86 ± 0.40
MWp1 0.100 0.049*
MWp2 0.100

p: p value for comparing between the three genotypes

p1 : p value for comparing between CC with each of CT and TT

p2 : p value for comparing between AG and AA

MC: Monte Carlo test

FE: Fisher Exact test

KW: Kruskal Wallis test

MW: Mann Whitney test

*: Statistically significant at p ≤ 0.05

3- Statistical Analysis of the Data (20)

Data were fed to the computer and analyzed using IBM SPSS software package version 20.0. (21)

Qualitative data were described using number and percent. Quantitative data were described using mean and standard deviation, median, minimum and maximum.

Comparison between different groups regarding categorical variables was tested using Chisquare test. When more than 20% of the cells have expected count less than 5, correction for chi-square was conducted using Fisher’s Exact test or Monte Carlo correction.

The distributions of quantitative variables were tested for normality using Kolmogorov-Smirnov test, Shapiro-Wilk test and D’Agstino test, also Histogram and QQ plot were used for vision test. If it reveals normal data distribution, parametric tests were applied. If the data were abnormally distributed, nonparametric tests were used.

For normally distributed data, comparison between two independent populations was done using independent t-test while more than two populations were analyzed F-test (ANOVA) to be used and Post Hoc test (Scheffe). For abnormally distributed data, comparison between two independent populations were done using Mann Whitney test while Kruskal Wallis test was used to compare between different groups. Significant test results are quoted as two-tailed probabilities. Significance of the obtained results was judged at the 5% level.

Results

Patients of both sexes were more often smokers, had a higher prevalence of hypertension, diabetes and a more unfavorable lipid profile compared with controls. The inflammatory marker, hs-CRP, was markedly increased in patients compared with controls. Also, CK-total, CK-MB, troponin, AST and LDH were markedly increased in patients compared with controls. (Table 1)

Regarding the different PLA2G7 A379V genotype distributions between the 2 studied groups, we found that homozygous CC genotype had the highest frequency among patients (72%) compared with controls (46%), while we found that heterozygous CT genotype had the highest frequency among controls (46%) compared with patients (24%) with a statistically significant difference (p=0.033). (Figure 1)

Figure 1

Comparison between the two studied groups according to different genotype distributions (p=0.033) and allele frequencies (p=0.012).

icjf.2014.1.3.155.g001.jpg

Table 5

The observed and expected values of the Lp-PLA2 A379V genotype frequencies among the whole studied population, among patients and among controls.

Genotype Observed Expected Difference
In all subjects
CC 59 58.5 (p2X 100) 0.5
TC 35 35.9 (2pqX 100) 0.9
TT 6 5.5 (q2X 100) 0.5
Total =100
Among patients
CC 36 35.28 (p2X 50) 0.72
TC 12 13.44 (2pqX50) 1.44
TT 2 1.28 (q2X 50) 0.72
Total =50
Among controls
CC 23 23.8 (p2X 50) 0.8
TC 23 21.4 (2pqX50) 1.6
TT 4 4.8 (q2X 50) 0.8
Total =50

Also, we found that the major “C” allele had the highest frequency among patients (84%) compared with controls (69%), while we found that the minor “T” allele had the highest frequency among controls (31%) compared with patients (16%) with a significant difference (p=0.012) between both groups with predominance of the “C” allele, coding for alanine, among patients and the minor “T” allele, coding for valine among controls. (Figure 1)

Our results showed no difference in genotype distributions or allele frequencies among patients regarding their sex. Also, there was no statistically significant difference between the different genotypes regarding the patients’ lipid profile [TG, cholesterol, LDL, HDL, (Table 2)] or cardiac enzyme levels [CK, CK-MB, troponin, AST, LDH, (Table 3)]. However, a statistically significant difference (p=0.043) was found between different genotypes regarding hs-CRP, (Table 4).

Validity of Hardy-Weinberg equilibrium regarding the 3 genotypes of the Lp-PLA2 A379V in all the studied population:

As shown in table 5, the incidence of the C allele (p) = [(2X59) + 35]/ 200= 0.765 and the incidence of the T allele (q) = [35 + (2X6)]/ 200 =0.235. {p+q=1}. The observed and expected values were found nearly identical. This means that the Egyptian population is in Hardy-Weinberg equilibrium for the Lp-PLA2 A379V gene variant.

Validity of Hardy-Weinberg equilibrium regarding the 3 genotypes of the Lp-PLA2 A379V gene among patients:

As shown in table 6, the incidence of the C allele (p) = [(2X36) + 12] / 100 = 0.84 and the incidence of the T allele (q) = [12 + (2X2)]/ 100 = 0.16. {p+q=1}. The observed and expected values were found to be quite similar denoting that Egyptian patients having MI are in Hardy-Weinberg equilibrium for the Lp-PLA2 A379V gene variant.

Validity of Hardy-Weinberg equilibrium regarding the 3 genotypes of the Lp-PLA2 A379V gene among healthy subjects:

As shown in table 7, the incidence of the C allele (p) = [(2X23) + 23]/ 100 = 0.69 and the incidence of the T allele (q) = [23 + (2X4)]/ 100 =0.31. {p+q=1}. The observed and expected values were found to be quite similar meaning that the controls are also in Hardy-Weinberg equilibrium for the Lp-PLA2 A379V gene variant.

Discussion

In our study, we found that homozygous CC genotype, coding for alanine at position 379 of Lp-PLA2 protein, had the highest frequency among patients compared with controls and was associated with increased incidence of MI, while we found that heterozygous CT genotype had the highest frequency among controls compared with patients and was associated with decreased incidence of MI, with a statistically significant difference (p=0.033) between patients and controls. The allelic frequencies for Lp-PLA2 A379V (46672943 C > T) SNP in our studied population did not show any deviation from Hardy- Weinberg equilibrium.

Also, we found that the major “C” allele, coding for alanine, had the highest frequency among patients compared with controls and was associated with increased incidence of MI, while we found that the minor “T” allele, coding for valine, had the highest frequency among controls compared with patients and was associated with decreased incidence of MI. So, there is a significant difference (p=0.012) between patients and controls with predominance of C allele in patients and T allele in controls.

In agreement with our study, Ninio E et al., 22 Abuzeid AM et al., 23 and Ling LC et al., 24 reported that the homozygous (TT) and heterozygous (CT) forms of 379V polymorphism were less frequent in MI patients than in controls, suggesting that this allele might be protective against the development of CAD while A379 variant was more prevalent among patients.

In contrast to our study, Liu PY et al.,25 and Casas JP et al.,16 reported that 379V gene variant was more prevalent in Taiwanese patients who presented with acute coronary syndrome (ACS) than in controls. Also, Sutton et al.,26 reported that 379V polymorphism was more prevalent among MI patients than controls with a significant difference (p=0.002) which was against our results. This dissimilarity in results may be due to differences in ethnic groups, sample size and selection criteria of patients and controls. However, Wotton P et al.,27 reported absence of any significant association between this polymorphism and coronary heart disease complications. In a Chinese study, the risk of MI was found to be higher among cardiovascular patients harboring the minor T allele compared with the major C allele.17 In a Taiwanese study, the T allele (379V polymorphism) was associated with lower Lp-PLA2 activity and increased risk of MI.18 In contrast, a study of European Caucasians revealed that T allele was associated with reduced risk of MI.23 But other studies on European Caucasians reported no association with CHD risk.16, 28 In South Koreans, a similar lack of association between A379V and CVD was reported.19

Personalized medicine is of growing interest, with a number of pharmacogenetic drug examples, like clopedogril and warfarin, where genetic variants influence the rate of drug metabolism and efficacy.29 Among the limitations of our study are the relatively small sample size and the inability to correlate the studied polymorphism with enzyme activity or mass.

It could be concluded from this study that the Lp-PLA2 A379V polymorphism was less frequent in Egyptians having MI than in healthy controls and was associated with a lower risk of cardiovascular events, suggesting that the minor T allele, coding for valine, might be protective against the development of MI while A379 variant was more prevalent among patients than controls, suggesting that the major “C” allele, coding for alanine could be used a risk factor for the development of MI. Moreover, there was no significant correlation between A379 and lipid profile, suggesting that the action of this enzyme is independent of other traditional risk factors. So, patients harboring the Lp-PLA2 A379 gene variant, or the C allele, might be candidates for specific Lp-PLA2 enzyme inhibitors, as darapladib.

References

1. 

Ross R ‘Atherosclerosis- an inflammatory disease’.. N Engl J Med 1999; 340: (2)115–26

2. 

Tsoukatos DC, Arborati M, Liapikos T, Clay KL, Murphy RC, Chapman MJ et al ‘Copper-catalyzed oxidation mediates PAF formation in human LDL subspecies. Protective role of PAF: acetylhydrolase in dense LDL’.. Arterioscler Thromb Vasc Biol. 1997; 17: (12)3505–12

3. 

Heery JM, Kozak M, Stafforini DM, Jones DA, Zimmerman GA, McIntyre TM et al ‘Oxidatively modified LDL contains phospholipids with plateletactivating factor-like activity and stimulates the growth of smooth muscle cells’.. J Clin Invest. 1995; 96: (5)2322–30

4. 

Prescott SM, Zimmerman GA, Stafforini DM, McIntyre TM ‘Plateletactivating factor and related lipid mediators’.. Annu Rev Biochem. 2000; 69: 419–45

5. 

Nakamura M, Honda Z, Izumi T, Sakanaka C, Mutoh H, Minami M et al ‘Molecular cloning and expression of platelet-activating factor receptor from human leukocytes’.. J Biol Chem. 1991; 266: (30)20400–5

6. 

Stafforini DM, McIntyre TM, Carter ME, Prescott SM ‘Human plasma platelet-activating factor acetylhydrolase. Association with lipoprotein particles and role in the degradation of platelet-activating factor’.. J Biol Chem. 1987; 262: (9)4215–22

7. 

Tselepis AD, Dentan C, Karabina SA, Chapman MJ, Ninio E ‘PAFdegrading acetylhydrolase is preferentially associated with dense LDL and VHDL-1 in human plasma: Catalytic characteristics and relation to the monocyte-derived enzyme’.. Arterioscler Thromb Vasc Biol. 1995; 15: (10)1764–73

8. 

Steinberg D ‘Low density lipoprotein oxidation and its pathobiological significance’.. J Biol Chem. 1997; 272: (34)20963–6

9. 

Farr RS, Cox CP, Wardlow ML, Jorgensen R ‘Preliminary studies of an acid-labile factor (ALF) in human sera that inactivates platelet activating factor (PAF)’.. Clin Immunol Immunopathol. 1980; 15: (3)318–30

10. 

Blackie JA, Bloomer JC, Brown MJ, Cheng HY, Hammond B, Hickey DM et al ‘The identification of clinical candidate SB-480848: a potent inhibitor of lipoprotein-associated phospholipase A2’.. Bioorg Med Chem Lett. 2003; 13: (6)1067–70

11. 

Wilensky RL, Shi Y, Mohler ER 3rd, Hamamdzic D, Burgert ME, Li J et al ‘Inhibition of lipoprotein-associated phospholipase A2 reduces complex coronary atherosclerotic plaque development’.. Nat Med. 2008; 14: (10)1059–66

12. 

Bell R, Collier DA, Rice SQ, Roberts GW, MacPhee CH, Kerwin RW et al ‘Systematic screening of the LDL-PLA2 gene for polymorphic variants and case control analysis in schizophrenia’.. Biochem Biophys Res Commun. 1997; 241: (3)630–5

13. 

Kruse S, Mao XQ, Heinzmann A, Blattmann S, Roberts MH, Braun S et al ‘The Ile198Thr and Ala379Val variants of plasmatic PAF-acetylhydrolase impair catalytical activities and are associated with atopy and asthma’.. Am J Hum Genet. 2000; 66: (5)1522–30

14. 

Stafforini DM, Satoh K, Atkinson DL, Tjoelker LW, Eberhardt C, Yoshida H et al ‘Platelet-activating factor acetylhydrolase deficiency. A missense mutation near the active site of an anti-inflammatory phospholipase’.. J Clin Invest. 1996; 97: (12)2784–91

15. 

Stafforini DM ‘Functional consequences of mutations and polymorphisms in the coding region of the PAF acetylhydrolase (PAF-AH) gene’.. Pharmaceuticals. 2009; 2: 94–117

16. 

Casas JP, Ninio E, Panayiotou A, Palmen J, Cooper JA, Ricketts SL et al ‘PLA2G7 genotype, lipoprotein-associated phospholipase A2 activity and coronary heart disease risk in 10 494 cases and 15 624 controls of European ancestry’.. Circulation. 2010; 121: (21)2284–93

17. 

Li L, Qi L, Lv N, Gao Q, Cheng Y, Wei Y et al ‘Association between lipoprotein-associated phospholipase A2 gene polymorphism and coronary artery disease in the Chinese Han population’.. Ann Hum Genet. 2011; 75: (5)605–11

18. 

Liu PY, Li YH, Wu HL, Chao TH, Tsai LM, Lin LJ et al ‘Platelet-activating factor-acetylhydrolase A379V (exon 11) gene polymorphism is an independent and functional risk factor for premature myocardial infarction’.. J Thromb Haemost. 2006; 4: (5)1023–8

19. 

Jang Y, Kim OY, Koh SJ, Chae JS, Ko YG, Kim JY et al ‘The Val279Phe variant of the lipoprotein-associated phospholipase A2 gene is associated with catalytic activities and cardiovascular disease in Korean men’.. J Clin Endocrinol Metab. 2006; 91: (9)3521–7

20. 

Leslie E, Geoffrey J, James M ‘Statistical analysis. In: Interpretation and uses of medical statistics’. (4th ed).Oxford Scientific Publications.1991; pp.411–6

21. 

Kirkpatrick LA, Feeney BC ‘A simple guide to IBM SPSS statistics for version 20.0’. Student ed.. Belmont, Calif.: Wadsworth, Cengage Learning.2013; 115

22. 

Ninio E, Tregouet D, Carrier JL, Stengel D, Bickel C, Perret C et al ‘Platelet-activating factor-acetylhydrolase and PAF-receptor gene haplotypes in relation to future cardiovascular event in patients with coronary artery disease’.. Hum Mol Genet. 2004; 13: (13)1341–51

23. 

Abuzeid AM, Hawe E, Humphries SE, Talmud PJ ‘Association between the Ala379Val variant of the lipoprotein associated phospholipase A2 and risk of myocardial infarction in the north and south of Europe’.. Atherosclerosis 2003; 168: (2)283–8

24. 

Ling LC, Ai-Jun MA, Kun W ‘Association between Lp-PLA2 Gene A379V Polymorphism and TOAST Classification’.. Chinese Journal of Stroke. 2012; 7: (11)858–63

25. 

Liu PY, Chung HC, Chen JY, Lee CH, Chan SH, Li YH et al ‘Plateletactivating factor-acetylhydrolase (PLA2G7) A379V (Exon 11) gene polymorphism is functionally associated with coronary artery disease severity but not the onset of acute coronary syndrome’.. Act Cardiol Sin. 2006; 22: 212–20

26. 

Sutton BS, Crosslin DR, Shah SH, Nelson SC, Bassil A, Hale AB et al ‘Comprehensive genetic analysis of the platelet activating factor acetylhydrolase (PLA2G7) gene and cardiovascular disease in case-control and family data sets’.. Hum Mol Genet. 2008; 17: (9)1318–28

27. 

Wootton PT, Stephens JW, Hurel SJ, Durand H, Cooper J, Ninio E et al ‘Lp-PLA2 activity and PLA2G7 A379V genotype in patients with diabetes mellitus’.. Atherosclerosis. 2006; 189: (1)149–56

28. 

Grallert H, Dupuis J, Bis JC, Dehghan A, Barbalic M, Baumert J et al ‘Eight genetic loci associated with variation in lipoprotein-associated phospholipase A2 mass and activity and coronary heart disease: metaanalysis of genome-wide association studies from five community-based studies’.. Eur Heart J. 2012; 33: (2)238–51

29. 

Morner S, Henein M Cardiovascular genetics: the ultimate investigation for optimum management?. International cardiovascular forum.. 2013; 1: (2)57–8



Copyright (c) 2015 The Authors

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.